FLU SINGAPURA – HFMD – KTM

DEFINISI

“Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

KOMPLIKASI

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) – EV 70
3. Acute Lymphonodular Pharyngitis – Cox A 10

LABORATORIUM :

Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :

o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :

RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :

Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :

o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :

Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Sumb: http://www.infeksi.com

Satu Tanggapan to “FLU SINGAPURA – HFMD – KTM”

  1. hanselzen Says:

    Lucu juga ya kalo udah sampe Indonesia namanya jadi Flu Singapura. Padahal di Singapura sendiri namanya HFMD.

    “hehehe… tp mkn ini baik untuk indonesia, bahwa ga selalu yg keren2 yg dihubungkan dg singapura”


Tinggalkan Balasan

Isikan data di bawah atau klik salah satu ikon untuk log in:

Logo WordPress.com

You are commenting using your WordPress.com account. Logout / Ubah )

Gambar Twitter

You are commenting using your Twitter account. Logout / Ubah )

Foto Facebook

You are commenting using your Facebook account. Logout / Ubah )

Foto Google+

You are commenting using your Google+ account. Logout / Ubah )

Connecting to %s

%d blogger menyukai ini: